Association Alopecia Areata | Analysis of the corneodesmosin genetic variants In uk alopecia areata patients

Analysis of the corneodesmosin genetic variants In uk alopecia areata patients

Auteur : Dr. Rachid TAZI-AHNINI (Biomedical Genetics – Division of Genomic Medicine – University of Sheffield Medical School – The Royal Hallamshire Hospital – Beech Hill Road – Sheffield S10 2RX ENGLAND).

Travail subventionné par l’AAA (subvention 2008-2009) à hauteur de 7 600 €.

Subvention débloquée le 29 décembre 2009.

Compte rendu fourni le 7 décembre 2010.

 

COMPTE RENDU DETAILLE (texte intégral)

Scientific report 2010

Analysis of the Corneodesmosin genetic variants

in UK alopecia areata patients

Introduction

Corneodesmosin is known to be important in the physiology of normal skin and hair (1) and a nonsense mutation in the CDSN gene has previously detected in families with hypotrichosis simplex (2). In this study, we sought to determine whether variants in the MHC CDSN gene may confer susceptibility to the common hair disorders alopecia areata (AA).

Methods for PCR amplification and genotyping

Over 30 SNPs have been identified within CDSN gene. To reduce number of SNPs to be genotype and without losing significant amount of information for genetic analysis we used HapMap to select tagSNPs within the CDSN gene. HapMap allowed us to identify 7 SNPs that will give equivalent information to the one all 30 SNPs would have given.

Each SNP has been amplified according to PCR conditions described below then PCR products have been digested and allelic discrimination has been performed on agarose or acrylamide gel

Rs2302399 CDSN1 (C/T)

Gtggccatgggtaccccacactgcagccactgctgctgctgagtaggcagatgcaccgggctgattaccacgctcctcccggccacaccaacttcccctgggg
cacccaccccctccacctctcctcctctccccacagtgactcctgcccagggaatgtccagctctggcataaaggacccgggtgtccttgagctgcc

ATCAGTCAGGAGGCCGTGCAGT

CCGAGATGGGCTCGTCTCGGGCACCCTGGATGGGGCGTGTGGGTGGGCACGGGATGATGGCACTGCTGCTGGCTGGT

Forward primer= gtggccatgggtaccccacactg (named CDSN1 FOR)

Reverse primer= ACCAGCCAGCAGCAGTGCCATC (named CDSN1 REV)

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

MgCl2           0.5ul

Q solution           5ul

dH2O           12.25ul

Taq ploymerase   0.25ul

Template           2ul

Denaturation at 95 °C, Annealing at 64 °C, Extension at 72 °C, 35 cycles.

The program on PCR machine :

Folder name is MIRANDA

Pogram name is CDSN2

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest with BslI

CC CT TT
151 151 151
101 101
77 77
46 46 46
24 24
1 1 1

 

10*buffer3               2.5ul/each

Bsl I                   0.5ul (5 units of enzyme for each reaction)

dH2O                     2ul

Incubate at 55 °C

Load the digested samples on polyacrylamide gels to see their different fragments. The protocol of polyacrylamide gel is on page 11.

Rs3094211 CDSN2 (C/T)

taacacgtgggacctggaggggctagggaaggcagaaggaacgcaggtgaaagagtcatggaggacca

c

ggggtaagttgggcctggggttttgagcaaaggaaaggaaagataaggaaagatgtggctccacatccctgaggg

Forward primer= taacacgtgggacctggagg (named CDSN2 FOR)

Reverse primer= CCCTCAGGGATGTGGAGCCAC (named CDSN2 REV)

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

dH2O           17.75ul

Taq ploymerase   0.25ul

Template           2ul

Denaturation at 95 °C, Annealing at 64 °C, Extension at 72 °C, 35 cycles.

The program on PCR machine :

Folder name is MIRANDA

Pogram name is CDSN2

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest with NcoI

 

TT CT CC
145 145
78 78
67 67

 

10*buffer3               2.5ul/each

Nco I                     0.5ul (5 units of enzyme for each reaction)

dH2O                     2ul

Incubate at 37 °C

Load the digested samples on a 1.5% agarose gel to see their different fragments.

 

Rs3130989 (CDSN3) C/G

gctctgtttgtaacacgtgggacctggaggggctagggaaggcagaagga

acgcaggtgaaagagtcatggaggaaccacggggtaagttgggcctggggtttt

g

aTcaaaggaaaggaaagataaggaaagatgtggc

Forward primer = GCTCTGTTTGTAACACGTGGGACC (named CDSN-INT1734-FOR)

 

Reverse primer = GCCACATCTTTCCTTATCTTTCCTTTCCTTTGAT (named CDSN-INT1734-MOD- REV)

 

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

dH2O           17.75ul

Taq ploymerase   0.25ul

Template          2ul

Denaturation at 95 °C, Annealing at 60 °C, Extension at 72 °C, 35 cycles.

 

The program on PCR machine :

Folder name is MIRANDA

Pogram name is 3130989

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest with Bcl I (T^GATC_A)

 

GG GC CC
139 139
104 104
35 35

 

10*buffer3                 2.5ul/each reaction

Bcl I                   0.4ul/each reaction (5 units of enzyme for each reaction)

dH2O                    2.1ul/each reaction

Incubate at 50 °C

Load the digested samples on polyacrylamide gels to see their different fragments.

Rs3130986 (CDSN4) A/G

gtgtctccacttctcagccctccattgttttgccttttgtc

ttcttccctttggtcccactgtctggcccaggatttttcccctaagaatttacgcctgga

ctcctcagagcctcagtttccccaattctctgtctcttcagggtcctttcttttagacct

acttgttcctgccccttctccattccctcttctttttaaaaaaaattttaattaaaaaac

aaaatacagacggggtctatgttgcccaggctggtcttgaactctggggcgcatgcaatc

ctcccacctcggcctcccaaagtgctgggattaccggcgtgagccactgtgcccagcccc

ctcttatattcaatgtattcctttgagg

c

cactcactttggcacctaattttctattttt

ctggttggtgtttgcccacccttcccaaacaaagaaatgcctttattcggccacctcaat

atcctttagagacaatagccagttcttcctcctttctccatccctaaactctccctgcgc

tctgcttgggagaaacccgagaggccgatgactgagataaggcagaaaggtgagggagga

agccaagcctccttggcccttactaaccactgctttcctccacag

 

GGACCTTGGCTAAGAGCATTGGCACCTTCTCAGACCCTTGTAAGGACCCCACGCGTATCACCTCCCCTAACGACCCC
TGCCTCACTGGGAAGGGTGACTCCAGCGGTTTCAGTAGCTACAGTGGCTCCAGCAGTTC

Forward primer (20 bp) = gtgtctccacttctcagccc (named CDSN4 FOR)

 

Reverse primer (21 bp) =GAACTGCTGGAGCCACTGTAG (named CDSN4 REV)

 

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

dH2O           17.75ul

Taq ploymerase   0.25ul

Template          2ul

Denaturation at 95 °C, Annealing at 68 °C, Extension at 72 °C, 35 cycles.

 

The program on PCR machine :

Folder name is MIRANDA

Pogram name is CDSN4

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest with CspCI

 

CC CT TT
762 762
368 368
359 359
35 35

 

10*buffer2             2.5ul/each reaction

CspC I               1ul/each reaction (5 units of enzyme for each reaction)

dH2O                 1.4844ul/each reaction

SAM                 0.0156ul/each reaction

Incubate at 37 °C

Load the digested samples on polyacrylamide gels to see their different fragments.

 

Rs707913 (CDSN5) (T/C) = 619

AGCAGCTTTCAGTTCAGCAGCAGCAGCTTCCAAGTAGGGAATGGCTCTGCTCTGCCAACCAATGACAACTCTTACCGCGGAATACTAAACCCTTCCCAGCCTGGACAAAGCTCTTCCTCTTCCCAGACCTT

 

TGGGGTATCCAGCAGTGGCCAAAGCGTCAGCTCCAACCAGCGTCCCTGTAGTTCGGACATCCCCGACTCTCCCTGCAGTGGAGGGCCCATCGTCTCGCACTCCGGCCCCTACATCCCCAGCTCCCACTCT

Forward primer = AGCAGCTTTCAGTTCAGCAGCAG (named S5)

 

Reverse primer = AGAGTGGGAGCTGGGGATGTA (named S6)

 

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

dH2O           17.75ul

Taq ploymerase   0.25ul

Template           2ul

Denaturation at 95 °C, Annealing at 62 °C, Extension at 72 °C, 35 cycles.

 

The program on PCR machine :

Folder name is MIRANDA

Pogram name is 619

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest with Mnl I

TT CT CC
126 126 126
79 79
67 67
56 56 56
12 12 12

 

10*buffer2               2.5ul/each

Mnl I                     1ul (5 units of enzyme for each reaction)

100*BSA                 0.25ul

dH2O                   1.25ul

Incubate at 37 °C

Load the digested samples on polyacrylamide gels to see their different fragments.

Rs1042127 (CDSN6) G/T = 1236

CATTGCATTCCAGCCAGTGGGGACTGGTGGGGTCCAGCTCTGTGGAGGCGGCTCCACGGGCTCCAAGGGACCCTGCTCTCCCTCCAGTTCTCGAGTCCCCAGCAGTTCTAGCATTTCCAGCAGCTCCGGTTTACCCTACCATCCCTGCGGCAGTGCTTCCCAGAGCCCCTGCTCCCCACCAGGCACCGGCTCCTTCAGCAGCAGCTCCAGTT

Forward primer = CATTGCATTCCAGCCAGTGG (named S15)

Reverse primer = AACTGGAGCTGCTGCTGAAGGA (named S16)

Denaturation at 95 °C, Annealing at 58 °C, Extension at 72 °C, 35 cycles.

The program on PCR machine :

Folder name is MIRANDA

Pogram name is 1243

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest : Alu I

TT GT GG
167 167
86 86
81 81
37 37 37
8 8 8

10*buffer2               2.5ul/each

Alu I                     0.5ul (5 units of enzyme for each reaction)

dH2O                     2ul

Incubate at 37 °C

Load the digested samples on polyacrylamide gels to see their different fragments.

Rs3094220 (CDSN7) C/T

GTCCCTGGATCCTGGACAGATGGCTCAGTAAACTGTGGGGACTAGGTGCAGACTTTTTGCCTTCTTGGAGTCCTGGGTCTCCTCTGAGAGTCTGGGTGGTGCTC

T

TCCTACGCCTCTAGAGGTCTCTGTGTTCCTCATTTTCCTTCAAAAGCGGGCTGTGTTTCTCTTCTACCTTCCAGCTGCTCCCACAGAGGAGGAAGACAATAAATATTTGTTGAACTGAaagcagagattgcctggcct

Forward primer = GTCCCTGGATCCTGGACAG (named CDSN7 FOR2)

Reverse primer = AGGCCAGGCAATCTCTGC (named CDSN7 REV)

Master mix for each reaction :

10*Buffer         2.5ul

Forward primer       1ul

Reverse primer       1ul

dNTP             0.5ul

dH2O           17.75ul

Taq ploymerase   0.25ul

Template           2ul

Denaturation at 95 °C, Annealing at 64 °C, Extension at 72 °C, 35 cycles.

The program on PCR machine :

Folder name is MIRANDA

Pogram name is CDSN2

Load the PCR products on a 1.5% agarose gel to check if the DNA region is amplified.

Set vottage at 110-120V, run for 40-50mins.

Digest : EarI

TT CT CC
170 170
108 108
73 73 73
62 62

10*buffer1                   2.5ul/each

Ear I                         1ul (5 units of enzyme for each reaction)

dH2O                       1.5ul

Incubate at 37 °C

Load the digested samples on polyacrylamide gels to see their different fragments.

Results

Allelic discrimination of all the CDSN SNPs was performed by PCR-RFLP.

SNP Alopecia

Areata

Patients

TOTAL
CDSN1 CC CT TT
1 95 72 168
CDSN2 CC CT TT
4 86 49 139
CDSN3 GG GC CC
CDSN4 CC CT TT
CDSN5 CC CT TT
CDSN6 CC CT TT
CDSN7 CC CT TT

 

SNP Healthy Control Samples TOTAL
CDSN1 CC CT TT
19 72 107 198
CDSN2 CC CT TT
19 69 90 178
CDSN3 GG GC CC
53 77 46 176
CDSN4 CC CT TT
51 80 54 185
CDSN5 CC CT TT
1 32 62 95
CDSN6 GG GT TT
6 47 135 188
CDSN7 CC CT TT
7 64 102 173

Numbers on blue colour give the genotyping status of each SNP. Genotyping of some SNPs has not been finished yet.

To give an idea about the significant of the results we obtained. We analyse data generated with the SNP1 (rs2302399). 168 patients with alopecia areata were included in the study. Genotyping was also performed in 198 normal control subjects.

Allelic discrimination of the CDSN single nucleotide polymorphism (SNP1 : rs2302399) was performed by PCR-RFLP.

Allelic Distribution in AA Subgroups
% CC CT TT
Patchy AA 0 57 43
Totalis 4 42 54
Universalis 0 62 38
Diffuse/ophiasis 0 57 43

Homozygotes for the rare C allele were significantly reduced in frequency in the AA patients compared to normal controls; odds ratio 0.056 [95% CI 0.007,0.26] (p<0.001). There was no significant difference between the genotypes on subdividing the AA patients by disease severity.

Discussion

The CDSN gene has been extensively studied in recent years as a candidate gene for psoriasis (3) although it has been very difficult to establish whether the nearby HLA Cw6 is the gene of primary importance in the pathogenesis. Corneodesmosin is expressed in the inner root sheath of the hair follicle and in view of the known associations of psoriasis and alopecia areata with HLA as well as the potential for functional involvement of corneodesmosin in hair growth, we considered the gene to

be appropriate for study in AA.

We found significant association between the CDSN (rs2302399) and AA. This maybe the case for other SNPs selected for this study. The genotyping of all CDSN SNPtag should be completed and genetic analysis of these SNPs may generate susceptibility haplotypes which could be analyse in the context of MHC as well. The pathogenetic significance of CDSN for alopecia areata is uncertain but the possibilities include a functional role for corneodesmosin in alopecia areata or alternatively, the association observed may be due to linkage disequilibrium with other loci in the MHC region such as HLA genes.

References

  1. Matsumoto M, et al. Targeted deletion of the murine corneodesmosin gene delineates its essential role in skin and hair physiology. Proc Natl Acad Sci U S A 2008 ; 105 : 6720-4.
  1. Levy-Nissenbaum E, Betz RC, et al. Hypotrichosis simplex of the scalp is associated with nonsense mutations in CDSN encoding corneodesmosin. Nat Genet 2003 ; 34 : 151-3.
  1. Capon F, et al. A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 2004 ; 13 : 2361-8.

Acknowledgment

This study was funded in part by “L’Association Alopecia Areta”, France and the Sheffield Hospitals.

Charitable Trust.

R Tazi-Ahnini

University of Sheffield, Sheffield S10 2JF, UK